<?xml version="1.0" encoding="UTF-8"?>
<itemContainer xmlns="http://omeka.org/schemas/omeka-xml/v5" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://omeka.org/schemas/omeka-xml/v5 http://omeka.org/schemas/omeka-xml/v5/omeka-xml-5-0.xsd" uri="https://www.socictopen.socict.org/items/browse/page/112?output=omeka-xml&amp;page=113&amp;sort_field=added" accessDate="2026-04-23T03:36:27+00:00">
  <miscellaneousContainer>
    <pagination>
      <pageNumber>112</pageNumber>
      <perPage>10</perPage>
      <totalResults>20655</totalResults>
    </pagination>
  </miscellaneousContainer>
  <item itemId="1119" public="1" featured="0">
    <fileContainer>
      <file fileId="1119">
        <src>https://www.socictopen.socict.org/files/original/3d4bfe033ba91dc7d10e76caef99e674.pdf</src>
        <authentication>d980bc9f26fb7e0dbb46eb56831877a5</authentication>
      </file>
    </fileContainer>
    <collection collectionId="1">
      <elementSetContainer>
        <elementSet elementSetId="1">
          <name>Dublin Core</name>
          <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
          <elementContainer>
            <element elementId="50">
              <name>Title</name>
              <description>A name given to the resource</description>
              <elementTextContainer>
                <elementText elementTextId="1">
                  <text>Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
            <element elementId="41">
              <name>Description</name>
              <description>An account of the resource</description>
              <elementTextContainer>
                <elementText elementTextId="2">
                  <text>Dominio científico: Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
          </elementContainer>
        </elementSet>
      </elementSetContainer>
    </collection>
    <itemType itemTypeId="1">
      <name>Text</name>
      <description>A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text.</description>
    </itemType>
    <elementSetContainer>
      <elementSet elementSetId="1">
        <name>Dublin Core</name>
        <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
        <elementContainer>
          <element elementId="50">
            <name>Title</name>
            <description>A name given to the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10652">
                <text>Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="39">
            <name>Creator</name>
            <description>An entity primarily responsible for making the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10653">
                <text>Chang Liu, Ze Chen, Yue Hu, Haishuo Ji, Deshui Yu, Wenyuan Shen, Si-Yu Li, Jishou Ruan, Wenjun Bu, Shan Gao</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="41">
            <name>Description</name>
            <description>An account of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10654">
                <text>In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes.</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="40">
            <name>Date</name>
            <description>A point or period of time associated with an event in the lifecycle of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10655">
                <text>2018</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="49">
            <name>Subject</name>
            <description>The topic of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10656">
                <text>palindromic small RNA, complemented palindromic small RNA, small RNA, DNA complemented palindrome, severe acute respiratory syndrome coronavirus</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="43">
            <name>Identifier</name>
            <description>An unambiguous reference to the resource within a given context</description>
            <elementTextContainer>
              <elementText elementTextId="10657">
                <text>DOI: 10.3390/genes9090442</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="48">
            <name>Source</name>
            <description>A related resource from which the described resource is derived</description>
            <elementTextContainer>
              <elementText elementTextId="10658">
                <text>Genes</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="45">
            <name>Publisher</name>
            <description>An entity responsible for making the resource available</description>
            <elementTextContainer>
              <elementText elementTextId="10659">
                <text>MDPI AG</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="38">
            <name>Coverage</name>
            <description>The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant</description>
            <elementTextContainer>
              <elementText elementTextId="10660">
                <text>Genetics</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="44">
            <name>Language</name>
            <description>A language of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10661">
                <text>EN</text>
              </elementText>
            </elementTextContainer>
          </element>
        </elementContainer>
      </elementSet>
    </elementSetContainer>
  </item>
  <item itemId="1120" public="1" featured="0">
    <fileContainer>
      <file fileId="1120">
        <src>https://www.socictopen.socict.org/files/original/632f6712cf8dc3944cd2a6f63c994f0e.pdf</src>
        <authentication>3644773fcfe02b14d003781b74d56771</authentication>
      </file>
    </fileContainer>
    <collection collectionId="1">
      <elementSetContainer>
        <elementSet elementSetId="1">
          <name>Dublin Core</name>
          <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
          <elementContainer>
            <element elementId="50">
              <name>Title</name>
              <description>A name given to the resource</description>
              <elementTextContainer>
                <elementText elementTextId="1">
                  <text>Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
            <element elementId="41">
              <name>Description</name>
              <description>An account of the resource</description>
              <elementTextContainer>
                <elementText elementTextId="2">
                  <text>Dominio científico: Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
          </elementContainer>
        </elementSet>
      </elementSetContainer>
    </collection>
    <itemType itemTypeId="1">
      <name>Text</name>
      <description>A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text.</description>
    </itemType>
    <elementSetContainer>
      <elementSet elementSetId="1">
        <name>Dublin Core</name>
        <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
        <elementContainer>
          <element elementId="50">
            <name>Title</name>
            <description>A name given to the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10662">
                <text>Going to Bat(s) for Studies of Disease Tolerance</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="39">
            <name>Creator</name>
            <description>An entity primarily responsible for making the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10663">
                <text>Judith N Mandl, Caitlin Schneider, David S. Schneider, Michelle L. Baker</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="41">
            <name>Description</name>
            <description>An account of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10664">
                <text>A majority of viruses that have caused recent epidemics with high lethality rates in people, are zoonoses originating from wildlife. Among them are filoviruses (e.g., Marburg, Ebola), coronaviruses (e.g., SARS, MERS), henipaviruses (e.g., Hendra, Nipah) which share the common features that they are all RNA viruses, and that a dysregulated immune response is an important contributor to the tissue damage and hence pathogenicity that results from infection in humans. Intriguingly, these viruses also all originate from bat reservoirs. Bats have been shown to have a greater mean viral richness than predicted by their phylogenetic distance from humans, their geographic range, or their presence in urban areas, suggesting other traits must explain why bats harbor a greater number of zoonotic viruses than other mammals. Bats are highly unusual among mammals in other ways as well. Not only are they the only mammals capable of powered flight, they have extraordinarily long life spans, with little detectable increases in mortality or senescence until high ages. Their physiology likely impacted their history of pathogen exposure and necessitated adaptations that may have also affected immune signaling pathways. Do our life history traits make us susceptible to generating damaging immune responses to RNA viruses or does the physiology of bats make them particularly tolerant or resistant? Understanding what immune mechanisms enable bats to coexist with RNA viruses may provide critical fundamental insights into how to achieve greater resilience in humans.</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="40">
            <name>Date</name>
            <description>A point or period of time associated with an event in the lifecycle of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10665">
                <text>2018</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="49">
            <name>Subject</name>
            <description>The topic of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10666">
                <text>bats (Chiroptera), viral immunology, host-pathogen interaction, disease tolerance, Comparative genome analyses, Innate Immunity</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="43">
            <name>Identifier</name>
            <description>An unambiguous reference to the resource within a given context</description>
            <elementTextContainer>
              <elementText elementTextId="10667">
                <text>DOI: 10.3389/fimmu.2018.02112</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="48">
            <name>Source</name>
            <description>A related resource from which the described resource is derived</description>
            <elementTextContainer>
              <elementText elementTextId="10668">
                <text>Frontiers in Immunology</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="45">
            <name>Publisher</name>
            <description>An entity responsible for making the resource available</description>
            <elementTextContainer>
              <elementText elementTextId="10669">
                <text>Frontiers Media S.A.</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="38">
            <name>Coverage</name>
            <description>The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant</description>
            <elementTextContainer>
              <elementText elementTextId="10670">
                <text>Immunologic diseases. Allergy</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="44">
            <name>Language</name>
            <description>A language of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10671">
                <text>EN</text>
              </elementText>
            </elementTextContainer>
          </element>
        </elementContainer>
      </elementSet>
    </elementSetContainer>
  </item>
  <item itemId="1121" public="1" featured="0">
    <fileContainer>
      <file fileId="1121">
        <src>https://www.socictopen.socict.org/files/original/30a099196326bf2e5c380d58336fd221.pdf</src>
        <authentication>dc395d7f09dffb9189253bf158bdb613</authentication>
      </file>
    </fileContainer>
    <collection collectionId="1">
      <elementSetContainer>
        <elementSet elementSetId="1">
          <name>Dublin Core</name>
          <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
          <elementContainer>
            <element elementId="50">
              <name>Title</name>
              <description>A name given to the resource</description>
              <elementTextContainer>
                <elementText elementTextId="1">
                  <text>Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
            <element elementId="41">
              <name>Description</name>
              <description>An account of the resource</description>
              <elementTextContainer>
                <elementText elementTextId="2">
                  <text>Dominio científico: Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
          </elementContainer>
        </elementSet>
      </elementSetContainer>
    </collection>
    <itemType itemTypeId="1">
      <name>Text</name>
      <description>A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text.</description>
    </itemType>
    <elementSetContainer>
      <elementSet elementSetId="1">
        <name>Dublin Core</name>
        <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
        <elementContainer>
          <element elementId="50">
            <name>Title</name>
            <description>A name given to the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10672">
                <text>Zooplankton in ancient and oligotrophic Lake Ohrid (Europe) in association with environmental variables</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="39">
            <name>Creator</name>
            <description>An entity primarily responsible for making the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10673">
                <text>Tasevska Orhideja, Špoljar Maria, Gušeska Dafina, Kostoski Goce, Patcheva Suzana, Sarafiloska Elizabeta Veljanoska</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="41">
            <name>Description</name>
            <description>An account of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10674">
                <text>Zooplankton is studied in the ancient, tectonic, oligomictic and oligotrophic Lake Ohrid (Macedonia, South Eastern Europe). The main aim of this study was to assess the seasonal and spatial patterns of the zooplankton functional feeding guilds in relation to the environmental conditions. Metalimnion of the lake was detected as the most productive environment, where biomass of the phytoplankton and abundance of the zooplankton reached their maxima. Pelagial zooplankton of low abundance (25 ± 22 ind. L−1) consisted of 16 species including two endemic copepods, Arctodiaptomus steindachneri (Richard, 1897) and Cyclops ochridanus (Kiefer, 1932). Copepods obtained remarkable share (60%) in the zooplankton assemblage. Microphagous zooplankton was mainly comprised of the most abundant rotifer Kellicottia longispina (Kellicott, 1879) in summer, and copepod nauplii during the spring Eudiaptomus gracilis (Sars, 1862) and C. ochridanus, and autumn C. ochridanus. Due to their requirements for the bacterio-detritus suspension, this microphagous zooplankton occupied aphotic hypolimnion during the entire study period. Raptorials were typically represented by copepodites and adult copepods in the metalimnion, and were significantly and positively affected by temperature (r = 0.417, p = 0.001), dissolved oxygen (r = 0.463, p = 0.0001) and, particularly, phytoplankton biomass (r = 0.708, p &lt; 0.00001). This is the first study in which the link between the lower and higher trophic levels is investigated in Lake Ohrid.</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="40">
            <name>Date</name>
            <description>A point or period of time associated with an event in the lifecycle of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10675">
                <text>2017</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="49">
            <name>Subject</name>
            <description>The topic of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10676">
                <text>copepods, rotifers, Microphgous, Raptorials, Metalimnion Oligomictic lake</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="43">
            <name>Identifier</name>
            <description>An unambiguous reference to the resource within a given context</description>
            <elementTextContainer>
              <elementText elementTextId="10677">
                <text>DOI: 10.1515/cjf-2017-0013</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="48">
            <name>Source</name>
            <description>A related resource from which the described resource is derived</description>
            <elementTextContainer>
              <elementText elementTextId="10678">
                <text>Croatian Journal of Fisheries</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="45">
            <name>Publisher</name>
            <description>An entity responsible for making the resource available</description>
            <elementTextContainer>
              <elementText elementTextId="10679">
                <text>Sciendo</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="38">
            <name>Coverage</name>
            <description>The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant</description>
            <elementTextContainer>
              <elementText elementTextId="10680">
                <text>Aquaculture. Fisheries. Angling</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="44">
            <name>Language</name>
            <description>A language of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10681">
                <text>EN, HR</text>
              </elementText>
            </elementTextContainer>
          </element>
        </elementContainer>
      </elementSet>
    </elementSetContainer>
  </item>
  <item itemId="1122" public="1" featured="0">
    <fileContainer>
      <file fileId="1122">
        <src>https://www.socictopen.socict.org/files/original/7933058ef0f8ad8f65b2de59ddad1cb6.pdf</src>
        <authentication>49ea5a948462f4adc0efdfc57257b402</authentication>
      </file>
    </fileContainer>
    <collection collectionId="1">
      <elementSetContainer>
        <elementSet elementSetId="1">
          <name>Dublin Core</name>
          <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
          <elementContainer>
            <element elementId="50">
              <name>Title</name>
              <description>A name given to the resource</description>
              <elementTextContainer>
                <elementText elementTextId="1">
                  <text>Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
            <element elementId="41">
              <name>Description</name>
              <description>An account of the resource</description>
              <elementTextContainer>
                <elementText elementTextId="2">
                  <text>Dominio científico: Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
          </elementContainer>
        </elementSet>
      </elementSetContainer>
    </collection>
    <itemType itemTypeId="1">
      <name>Text</name>
      <description>A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text.</description>
    </itemType>
    <elementSetContainer>
      <elementSet elementSetId="1">
        <name>Dublin Core</name>
        <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
        <elementContainer>
          <element elementId="50">
            <name>Title</name>
            <description>A name given to the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10682">
                <text>Deposition of respiratory virus pathogens on frequently touched surfaces at airports</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="39">
            <name>Creator</name>
            <description>An entity primarily responsible for making the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10683">
                <text>Niina Ikonen, Carita Savolainen-Kopra, Joanne E. Enstone, Ilpo Kulmala, Pertti Pasanen, Anniina Salmela, Satu Salo, Jonathan S. Nguyen-Van-Tam, Petri Ruutu, for the PANDHUB consortium</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="41">
            <name>Description</name>
            <description>An account of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10684">
                <text>Abstract Background International and national travelling has made the rapid spread of infectious diseases possible. Little information is available on the role of major traffic hubs, such as airports, in the transmission of respiratory infections, including seasonal influenza and a pandemic threat. We investigated the presence of respiratory viruses in the passenger environment of a major airport in order to identify risk points and guide measures to minimize transmission. Methods Surface and air samples were collected weekly at three different time points during the peak period of seasonal influenza in 2015–16 in Finland. Swabs from surface samples, and air samples were tested by real-time PCR for influenza A and B viruses, respiratory syncytial virus, adenovirus, rhinovirus and coronaviruses (229E, HKU1, NL63 and OC43). Results Nucleic acid of at least one respiratory virus was detected in 9 out of 90 (10%) surface samples, including: a plastic toy dog in the children’s playground (2/3 swabs, 67%); hand-carried luggage trays at the security check area (4/8, 50%); the buttons of the payment terminal at the pharmacy (1/2, 50%); the handrails of stairs (1/7, 14%); and the passenger side desk and divider glass at a passport control point (1/3, 33%). Among the 10 respiratory virus findings at various sites, the viruses identified were: rhinovirus (4/10, 40%, from surfaces); coronavirus (3/10, 30%, from surfaces); adenovirus (2/10, 20%, 1 air sample, 1 surface sample); influenza A (1/10, 10%, surface sample). Conclusions Detection of pathogen viral nucleic acids indicates respiratory viral surface contamination at multiple sites associated with high touch rates, and suggests a potential risk in the identified airport sites. Of the surfaces tested, plastic security screening trays appeared to pose the highest potential risk, and handling these is almost inevitable for all embarking passengers.</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="40">
            <name>Date</name>
            <description>A point or period of time associated with an event in the lifecycle of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10685">
                <text>2018</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="49">
            <name>Subject</name>
            <description>The topic of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10686">
                <text>Influenza virus, respiratory virus, surface contamination, airport</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="43">
            <name>Identifier</name>
            <description>An unambiguous reference to the resource within a given context</description>
            <elementTextContainer>
              <elementText elementTextId="10687">
                <text>DOI: 10.1186/s12879-018-3150-5</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="48">
            <name>Source</name>
            <description>A related resource from which the described resource is derived</description>
            <elementTextContainer>
              <elementText elementTextId="10688">
                <text>BMC Infectious Diseases</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="45">
            <name>Publisher</name>
            <description>An entity responsible for making the resource available</description>
            <elementTextContainer>
              <elementText elementTextId="10689">
                <text>BMC</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="38">
            <name>Coverage</name>
            <description>The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant</description>
            <elementTextContainer>
              <elementText elementTextId="10690">
                <text>Infectious and parasitic diseases</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="44">
            <name>Language</name>
            <description>A language of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10691">
                <text>EN</text>
              </elementText>
            </elementTextContainer>
          </element>
        </elementContainer>
      </elementSet>
    </elementSetContainer>
  </item>
  <item itemId="1123" public="1" featured="0">
    <fileContainer>
      <file fileId="1123">
        <src>https://www.socictopen.socict.org/files/original/5c313b20373c70766113b814c517a142.pdf</src>
        <authentication>9345e23482ada6111510329fad4a2df4</authentication>
      </file>
    </fileContainer>
    <collection collectionId="1">
      <elementSetContainer>
        <elementSet elementSetId="1">
          <name>Dublin Core</name>
          <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
          <elementContainer>
            <element elementId="50">
              <name>Title</name>
              <description>A name given to the resource</description>
              <elementTextContainer>
                <elementText elementTextId="1">
                  <text>Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
            <element elementId="41">
              <name>Description</name>
              <description>An account of the resource</description>
              <elementTextContainer>
                <elementText elementTextId="2">
                  <text>Dominio científico: Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
          </elementContainer>
        </elementSet>
      </elementSetContainer>
    </collection>
    <itemType itemTypeId="1">
      <name>Text</name>
      <description>A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text.</description>
    </itemType>
    <elementSetContainer>
      <elementSet elementSetId="1">
        <name>Dublin Core</name>
        <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
        <elementContainer>
          <element elementId="50">
            <name>Title</name>
            <description>A name given to the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10692">
                <text>Infectious Disease Threats in the Twenty-First Century: Strengthening the Global Response</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="39">
            <name>Creator</name>
            <description>An entity primarily responsible for making the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10693">
                <text>David E Bloom, Daniel Cadarette</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="41">
            <name>Description</name>
            <description>An account of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10694">
                <text>The world has developed an elaborate global health system as a bulwark against known and unknown infectious disease threats. The system consists of various formal and informal networks of organizations that serve different stakeholders; have varying goals, modalities, resources, and accountability; operate at different regional levels (i.e., local, national, regional, or global); and cut across the public, private-for-profit, and private-not-for-profit sectors. The evolving global health system has done much to protect and promote human health. However, the world continues to be confronted by longstanding, emerging, and reemerging infectious disease threats. These threats differ widely in terms of severity and probability. They also have varying consequences for morbidity and mortality, as well as for a complex set of social and economic outcomes. To various degrees, they are also amenable to alternative responses, ranging from clean water provision to regulation to biomedical countermeasures. Whether the global health system as currently constituted can provide effective protection against a dynamic array of infectious disease threats has been called into question by recent outbreaks of Ebola, Zika, dengue, Middle East respiratory syndrome, severe acute respiratory syndrome, and influenza and by the looming threat of rising antimicrobial resistance. The concern is magnified by rapid population growth in areas with weak health systems, urbanization, globalization, climate change, civil conflict, and the changing nature of pathogen transmission between human and animal populations. There is also potential for human-originated outbreaks emanating from laboratory accidents or intentional biological attacks. This paper discusses these issues, along with the need for a (possibly self-standing) multi-disciplinary Global Technical Council on Infectious Disease Threats to address emerging global challenges with regard to infectious disease and associated social and economic risks. This Council would strengthen the global health system by improving collaboration and coordination across organizations (e.g., the WHO, Gavi, CEPI, national centers for disease control, pharmaceutical manufacturers, etc.); filling in knowledge gaps with respect to (for example) infectious disease surveillance, research and development needs, financing models, supply chain logistics, and the social and economic impacts of potential threats; and making high-level, evidence-based recommendations for managing global risks associated with infectious disease.</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="40">
            <name>Date</name>
            <description>A point or period of time associated with an event in the lifecycle of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10695">
                <text>2019</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="49">
            <name>Subject</name>
            <description>The topic of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10696">
                <text>global health, global health systems, infectious disease, Outbreak, epidemic, Pandemic</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="43">
            <name>Identifier</name>
            <description>An unambiguous reference to the resource within a given context</description>
            <elementTextContainer>
              <elementText elementTextId="10697">
                <text>DOI: 10.3389/fimmu.2019.00549</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="48">
            <name>Source</name>
            <description>A related resource from which the described resource is derived</description>
            <elementTextContainer>
              <elementText elementTextId="10698">
                <text>Frontiers in Immunology</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="45">
            <name>Publisher</name>
            <description>An entity responsible for making the resource available</description>
            <elementTextContainer>
              <elementText elementTextId="10699">
                <text>Frontiers Media S.A.</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="38">
            <name>Coverage</name>
            <description>The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant</description>
            <elementTextContainer>
              <elementText elementTextId="10700">
                <text>Immunologic diseases. Allergy</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="44">
            <name>Language</name>
            <description>A language of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10701">
                <text>EN</text>
              </elementText>
            </elementTextContainer>
          </element>
        </elementContainer>
      </elementSet>
    </elementSetContainer>
  </item>
  <item itemId="1124" public="1" featured="0">
    <fileContainer>
      <file fileId="1124">
        <src>https://www.socictopen.socict.org/files/original/2b6320e78029356ec5eef4b0875667c4.pdf</src>
        <authentication>cd9303af497f3de605ef5a192887d45f</authentication>
      </file>
    </fileContainer>
    <collection collectionId="1">
      <elementSetContainer>
        <elementSet elementSetId="1">
          <name>Dublin Core</name>
          <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
          <elementContainer>
            <element elementId="50">
              <name>Title</name>
              <description>A name given to the resource</description>
              <elementTextContainer>
                <elementText elementTextId="1">
                  <text>Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
            <element elementId="41">
              <name>Description</name>
              <description>An account of the resource</description>
              <elementTextContainer>
                <elementText elementTextId="2">
                  <text>Dominio científico: Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
          </elementContainer>
        </elementSet>
      </elementSetContainer>
    </collection>
    <itemType itemTypeId="1">
      <name>Text</name>
      <description>A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text.</description>
    </itemType>
    <elementSetContainer>
      <elementSet elementSetId="1">
        <name>Dublin Core</name>
        <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
        <elementContainer>
          <element elementId="50">
            <name>Title</name>
            <description>A name given to the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10702">
                <text>Overview of Current Therapeutics and Novel Candidates Against Influenza, Respiratory Syncytial Virus, and Middle East Respiratory Syndrome Coronavirus Infections</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="39">
            <name>Creator</name>
            <description>An entity primarily responsible for making the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10703">
                <text>Mohammad Amin Behzadi, Victor H. Leyva-Grado</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="41">
            <name>Description</name>
            <description>An account of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10704">
                <text>Emergence and re-emergence of respiratory virus infections represent a significant threat to global public health, as they occur seasonally and less frequently (such as in the case of influenza virus) as pandemic infections. Some of these viruses have been in the human population for centuries and others had recently emerged as a public health problem. Influenza viruses have been affecting the human population for a long time now; however, their ability to rapidly evolve through antigenic drift and antigenic shift causes the emergence of new strains. A recent example of these events is the avian-origin H7N9 influenza virus outbreak currently undergoing in China. Human H7N9 influenza viruses are resistant to amantadines and some strains are also resistant to neuraminidase inhibitors greatly limiting the options for treatment. Respiratory syncytial virus (RSV) may cause a lower respiratory tract infection characterized by bronchiolitis and pneumonia mainly in children and the elderly. Infection with RSV can cause severe disease and even death, imposing a severe burden for pediatric and geriatric health systems worldwide. Treatment for RSV is mainly supportive since the only approved therapy, a monoclonal antibody, is recommended for prophylactic use in high-risk patients. The Middle East respiratory syndrome coronavirus (MERS-CoV) is a newly emerging respiratory virus. The virus was first recognized in 2012 and it is associated with a lower respiratory tract disease that is more severe in patients with comorbidities. No licensed vaccines or antivirals have been yet approved for the treatment of MERS-CoV in humans. It is clear that the discovery and development of novel antivirals that can be used alone or in combination with existing therapies to treat these important respiratory viral infections are critical. In this review, we will describe some of the novel therapeutics currently under development for the treatment of these infections.</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="40">
            <name>Date</name>
            <description>A point or period of time associated with an event in the lifecycle of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10705">
                <text>2019</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="49">
            <name>Subject</name>
            <description>The topic of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10706">
                <text>antiviral, influenza, Respiratory Syncytial Virus, MERS coronavirus, novel therapeutic agents</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="43">
            <name>Identifier</name>
            <description>An unambiguous reference to the resource within a given context</description>
            <elementTextContainer>
              <elementText elementTextId="10707">
                <text>DOI: 10.3389/fmicb.2019.01327</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="48">
            <name>Source</name>
            <description>A related resource from which the described resource is derived</description>
            <elementTextContainer>
              <elementText elementTextId="10708">
                <text>Frontiers in Microbiology</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="45">
            <name>Publisher</name>
            <description>An entity responsible for making the resource available</description>
            <elementTextContainer>
              <elementText elementTextId="10709">
                <text>Frontiers Media S.A.</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="38">
            <name>Coverage</name>
            <description>The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant</description>
            <elementTextContainer>
              <elementText elementTextId="10710">
                <text>Microbiology</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="44">
            <name>Language</name>
            <description>A language of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10711">
                <text>EN</text>
              </elementText>
            </elementTextContainer>
          </element>
        </elementContainer>
      </elementSet>
    </elementSetContainer>
  </item>
  <item itemId="1125" public="1" featured="0">
    <fileContainer>
      <file fileId="1125">
        <src>https://www.socictopen.socict.org/files/original/0797c3fb779f02e48fbf714744463680.pdf</src>
        <authentication>b9851bb40c66b8123736ee2b9b226815</authentication>
      </file>
    </fileContainer>
    <collection collectionId="1">
      <elementSetContainer>
        <elementSet elementSetId="1">
          <name>Dublin Core</name>
          <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
          <elementContainer>
            <element elementId="50">
              <name>Title</name>
              <description>A name given to the resource</description>
              <elementTextContainer>
                <elementText elementTextId="1">
                  <text>Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
            <element elementId="41">
              <name>Description</name>
              <description>An account of the resource</description>
              <elementTextContainer>
                <elementText elementTextId="2">
                  <text>Dominio científico: Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
          </elementContainer>
        </elementSet>
      </elementSetContainer>
    </collection>
    <itemType itemTypeId="1">
      <name>Text</name>
      <description>A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text.</description>
    </itemType>
    <elementSetContainer>
      <elementSet elementSetId="1">
        <name>Dublin Core</name>
        <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
        <elementContainer>
          <element elementId="50">
            <name>Title</name>
            <description>A name given to the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10712">
                <text>Des mers de glace à la Terre de feu</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="39">
            <name>Creator</name>
            <description>An entity primarily responsible for making the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10713">
                <text>Stéphen Rostain</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="40">
            <name>Date</name>
            <description>A point or period of time associated with an event in the lifecycle of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10714">
                <text>2008</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="49">
            <name>Subject</name>
            <description>The topic of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10715">
                <text>Archéologie</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="43">
            <name>Identifier</name>
            <description>An unambiguous reference to the resource within a given context</description>
            <elementTextContainer>
              <elementText elementTextId="10716">
                <text>DOI: 10.4000/nda.211</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="48">
            <name>Source</name>
            <description>A related resource from which the described resource is derived</description>
            <elementTextContainer>
              <elementText elementTextId="10717">
                <text>Les Nouvelles de l’Archéologie</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="45">
            <name>Publisher</name>
            <description>An entity responsible for making the resource available</description>
            <elementTextContainer>
              <elementText elementTextId="10718">
                <text>Editions de la Maison des Sciences de l'Homme</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="38">
            <name>Coverage</name>
            <description>The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant</description>
            <elementTextContainer>
              <elementText elementTextId="10719">
                <text>Archaeology</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="44">
            <name>Language</name>
            <description>A language of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10720">
                <text>FR</text>
              </elementText>
            </elementTextContainer>
          </element>
        </elementContainer>
      </elementSet>
    </elementSetContainer>
  </item>
  <item itemId="1126" public="1" featured="0">
    <fileContainer>
      <file fileId="1126">
        <src>https://www.socictopen.socict.org/files/original/58701c563247836aecc5616fcecb63b4.pdf</src>
        <authentication>2b72ae9da0932df59713163ef86a41c3</authentication>
      </file>
    </fileContainer>
    <collection collectionId="1">
      <elementSetContainer>
        <elementSet elementSetId="1">
          <name>Dublin Core</name>
          <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
          <elementContainer>
            <element elementId="50">
              <name>Title</name>
              <description>A name given to the resource</description>
              <elementTextContainer>
                <elementText elementTextId="1">
                  <text>Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
            <element elementId="41">
              <name>Description</name>
              <description>An account of the resource</description>
              <elementTextContainer>
                <elementText elementTextId="2">
                  <text>Dominio científico: Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
          </elementContainer>
        </elementSet>
      </elementSetContainer>
    </collection>
    <itemType itemTypeId="1">
      <name>Text</name>
      <description>A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text.</description>
    </itemType>
    <elementSetContainer>
      <elementSet elementSetId="1">
        <name>Dublin Core</name>
        <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
        <elementContainer>
          <element elementId="50">
            <name>Title</name>
            <description>A name given to the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10721">
                <text>Síndrome agudo respiratorio severo: un panorama mundial de la epidemia Severe acute respiratory syndrome: a global view of the epidemic</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="39">
            <name>Creator</name>
            <description>An entity primarily responsible for making the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10722">
                <text>Carlos Franco-Paredes, Pablo Kuri-Morales, Carlos Alvarez-Lucas, Ethel Palacios Zavala, Margarita Nava-Frías, Miguel Betancourt-Cravioto, José Ignacio Santos Preciado, Roberto Tapia Conyer</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="41">
            <name>Description</name>
            <description>An account of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10723">
                <text>A principios de febrero de 2003 la Organización Mundial de la Salud comenzó a recibir reportes de pacientes con un síndrome caracterizado por neumonía atípica, con rápida progresión hacia insuficiencia respiratoria sin una causa identificada. Los casos aparentemente se iniciaron en el sur de China y se han diseminado a otras regiones en Asia, Europa, Sudáfrica, Norte América y Sur América. La causa de este síndrome es una nueva variedad de Coronavirus, aislado en secreciones respiratorias y en otras. El síndrome ha sido definido en inglés como SARS (Severe acute respiratory syndrome) por la Organización Mundial de la Salud y se caracteriza por un periodo de incubación de 1 a 10 días (promedio de cinco días), una fase febril prodrómica que aparece entre los días 1 a 3. Posteriormente, aparecen síntomas respiratorios como tos, disnea, y signos como hipoxemia, que en 10 a 40% de los casos requieren de ventilación mecánica. La tasa de letalidad ha variado de 3% hasta 16%. Los hallazgos de laboratorio incluyen trombocitopenia, leucopenia, elevación de creatinin-fosfokinasa, y, en ocasiones, de transaminasas hepáticas y deshidrogenasa láctica. El tratamiento incluye medidas de apoyo; la utilización empírica del antiviral ribavirina es controvertida, debido a que hasta el momento no existe un tratamiento específico. Se recomienda el aislamiento respiratorio de los pacientes, la utilización de máscaras protectoras y el lavado estricto de manos como principales medidas de prevención. Desde el inicio de esta epidemia México estableció un sistema de vigilancia, así como recomendaciones al personal de salud para la identificación, prevención de casos secundarios y manejo clínico de casos sospechosos.In early February 2003, the World Health Organization (WHO) began receiving reports of patients with a syndrome characterized by an atypical pneumonia with rapid progression to respiratory failure without an identified cause despite extensive diagnostic workups. Most of these reports pointed out that the outbreak started in Southern China, specifically in the Guandong Province. The initial outbreak in South East Asia has already spread to other Regions in Asia, Europe, North and South America, and South Africa. Many of these cases can be linked through chains of transmission to an index case from the Guandong Province who visited Hong Kong. Although the exact mode of transmission has not been clearly established, the etiology of this syndrome has already been identified. A novel Coronavirus has been identified by electron microscopy and molecular assays in multiple laboratories from respiratory specimens throughout the world. The syndrome has been defined as SARS (Severe Acute Respiratory Syndrome) by WHO, and is characterized by an incubation period between 1 and 10 days (average 5 days) and by a febrile phase that usually lasts approximately 3 days. During the respiratory phase that begins around day 3, patients start developing a dry cough, shortness of breath and hypoxemia. Mechanical ventilatory support is required in about 10 to 40% of cases and the case-fatality rate ranges between 3 and 16%. The laboratory findings in SARS cases include leukopenia, thrombocytopenia, and a rise in transaminases and lactic dehydrogenase levels. Treatment of SARS includes supportive measures and the empiric use of ribavirin. Respiratory isolation, use of respiratory masks, and compulsory hand hygiene constitute the principal preventive measures. The confirmation of a case can be performed at reference laboratories by serologic and molecular assays. From the onset of this epidemic Mexico established a surveillance system as well as clinical guidelines and recommendations for the identification, prevention of secondary spread, and medical management of suspicious and probable cases by health care personnel.</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="40">
            <name>Date</name>
            <description>A point or period of time associated with an event in the lifecycle of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10724">
                <text>2003</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="49">
            <name>Subject</name>
            <description>The topic of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10725">
                <text>síndrome agudo respiratorio severo,  Insuficiencia respiratoria, coronavirus, Neumonía atípica, severe acute respiratory syndrome, respiratory in sufficiency, Pneumonia, atypical</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="43">
            <name>Identifier</name>
            <description>An unambiguous reference to the resource within a given context</description>
            <elementTextContainer>
              <elementText elementTextId="10726">
                <text>DOI: </text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="48">
            <name>Source</name>
            <description>A related resource from which the described resource is derived</description>
            <elementTextContainer>
              <elementText elementTextId="10727">
                <text>Salud Pública de México</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="45">
            <name>Publisher</name>
            <description>An entity responsible for making the resource available</description>
            <elementTextContainer>
              <elementText elementTextId="10728">
                <text>Instituto Nacional de Salud Pública</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="38">
            <name>Coverage</name>
            <description>The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant</description>
            <elementTextContainer>
              <elementText elementTextId="10729">
                <text>Public aspects of medicine</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="44">
            <name>Language</name>
            <description>A language of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10730">
                <text>EN, ES</text>
              </elementText>
            </elementTextContainer>
          </element>
        </elementContainer>
      </elementSet>
    </elementSetContainer>
  </item>
  <item itemId="1127" public="1" featured="0">
    <fileContainer>
      <file fileId="1127">
        <src>https://www.socictopen.socict.org/files/original/1cacf0c94b8c80d5e6b003f3741bc4e8.pdf</src>
        <authentication>a81525d9e2f677e4eb257aa9fcb07638</authentication>
      </file>
    </fileContainer>
    <collection collectionId="1">
      <elementSetContainer>
        <elementSet elementSetId="1">
          <name>Dublin Core</name>
          <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
          <elementContainer>
            <element elementId="50">
              <name>Title</name>
              <description>A name given to the resource</description>
              <elementTextContainer>
                <elementText elementTextId="1">
                  <text>Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
            <element elementId="41">
              <name>Description</name>
              <description>An account of the resource</description>
              <elementTextContainer>
                <elementText elementTextId="2">
                  <text>Dominio científico: Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
          </elementContainer>
        </elementSet>
      </elementSetContainer>
    </collection>
    <itemType itemTypeId="1">
      <name>Text</name>
      <description>A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text.</description>
    </itemType>
    <elementSetContainer>
      <elementSet elementSetId="1">
        <name>Dublin Core</name>
        <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
        <elementContainer>
          <element elementId="50">
            <name>Title</name>
            <description>A name given to the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10731">
                <text>Viral Innate Immune Evasion and the Pathogenesis of Emerging RNA Virus Infections</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="39">
            <name>Creator</name>
            <description>An entity primarily responsible for making the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10732">
                <text>Tessa Nelemans, Marjolein Kikkert</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="41">
            <name>Description</name>
            <description>An account of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10733">
                <text>Positive-sense single-stranded RNA (+ssRNA) viruses comprise many (re-)emerging human pathogens that pose a public health problem. Our innate immune system and, in particular, the interferon response form the important first line of defence against these viruses. Given their genetic flexibility, these viruses have therefore developed multiple strategies to evade the innate immune response in order to optimize their replication capacity. Already many molecular mechanisms of innate immune evasion by +ssRNA viruses have been identified. However, research addressing the effect of host innate immune evasion on the pathology caused by viral infections is less prevalent in the literature, though very relevant and interesting. Since interferons have been implicated in inflammatory diseases and immunopathology in addition to their protective role in infection, antagonizing the immune response may have an ambiguous effect on the clinical outcome of the viral disease. Therefore, this review discusses what is currently known about the role of interferons and host immune evasion in the pathogenesis of emerging coronaviruses, alphaviruses and flaviviruses.</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="40">
            <name>Date</name>
            <description>A point or period of time associated with an event in the lifecycle of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10734">
                <text>2019</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="49">
            <name>Subject</name>
            <description>The topic of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10735">
                <text>positive-sense single-stranded rna viruses, innate immune evasion, type i and iii interferons, viral pathogenesis</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="43">
            <name>Identifier</name>
            <description>An unambiguous reference to the resource within a given context</description>
            <elementTextContainer>
              <elementText elementTextId="10736">
                <text>DOI: 10.3390/v11100961</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="48">
            <name>Source</name>
            <description>A related resource from which the described resource is derived</description>
            <elementTextContainer>
              <elementText elementTextId="10737">
                <text>Viruses</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="45">
            <name>Publisher</name>
            <description>An entity responsible for making the resource available</description>
            <elementTextContainer>
              <elementText elementTextId="10738">
                <text>MDPI AG</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="38">
            <name>Coverage</name>
            <description>The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant</description>
            <elementTextContainer>
              <elementText elementTextId="10739">
                <text>Microbiology</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="44">
            <name>Language</name>
            <description>A language of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10740">
                <text>EN</text>
              </elementText>
            </elementTextContainer>
          </element>
        </elementContainer>
      </elementSet>
    </elementSetContainer>
  </item>
  <item itemId="1128" public="1" featured="0">
    <fileContainer>
      <file fileId="1128">
        <src>https://www.socictopen.socict.org/files/original/689e5cf458fd53a86ea56e76452f6cbb.pdf</src>
        <authentication>a5d12513b836b03579c33eb96ac185bb</authentication>
      </file>
    </fileContainer>
    <collection collectionId="1">
      <elementSetContainer>
        <elementSet elementSetId="1">
          <name>Dublin Core</name>
          <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
          <elementContainer>
            <element elementId="50">
              <name>Title</name>
              <description>A name given to the resource</description>
              <elementTextContainer>
                <elementText elementTextId="1">
                  <text>Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
            <element elementId="41">
              <name>Description</name>
              <description>An account of the resource</description>
              <elementTextContainer>
                <elementText elementTextId="2">
                  <text>Dominio científico: Coronavirus</text>
                </elementText>
              </elementTextContainer>
            </element>
          </elementContainer>
        </elementSet>
      </elementSetContainer>
    </collection>
    <itemType itemTypeId="1">
      <name>Text</name>
      <description>A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text.</description>
    </itemType>
    <elementSetContainer>
      <elementSet elementSetId="1">
        <name>Dublin Core</name>
        <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
        <elementContainer>
          <element elementId="50">
            <name>Title</name>
            <description>A name given to the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10741">
                <text>Evaluation of Machine Learning Models for Predicting Antimicrobial Resistance of Actinobacillus pleuropneumoniae From Whole Genome Sequences</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="39">
            <name>Creator</name>
            <description>An entity primarily responsible for making the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10742">
                <text>Zhichang Liu, Dun Deng, Huijie Lu, Jian Sun, Luchao Lv, Shuhong Li, Guanghui Peng, Xian-Yong Ma, Jiazhou Li, Zhenming Li, Ting Rong, Gang Wang</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="41">
            <name>Description</name>
            <description>An account of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10743">
                <text>Antimicrobial resistance (AMR) is becoming a huge problem in countries all over the world, and new approaches to identifying strains resistant or susceptible to certain antibiotics are essential in fighting against antibiotic-resistant pathogens. Genotype-based machine learning methods showed great promise as a diagnostic tool, due to the increasing availability of genomic datasets and AST phenotypes. In this article, Support Vector Machine (SVM) and Set Covering Machine (SCM) models were used to learn and predict the resistance of the five drugs (Tetracycline, Ampicillin, Sulfisoxazole, Trimethoprim, and Enrofloxacin). The SVM model used the number of co-occurring k-mers between the genome of the isolates and the reference genes to learn and predict the phenotypes of the bacteria to a specific antimicrobial, while the SCM model uses a greedy approach to construct conjunction or disjunction of Boolean functions to find the most concise set of k-mers that allows for accurate prediction of the phenotype. Five-fold cross-validation was performed on the training set of the SVM and SCM model to select the best hyperparameter values to avoid model overfitting. The training accuracy (mean cross-validation score) and the testing accuracy of SVM and SCM models of five drugs were above 90% regardless of the resistant mechanism of which were acquired resistant or point mutation in the chromosome. The results of correlation between the phenotype and the model predictions of the five drugs indicated that both SVM and SCM models could significantly classify the resistant isolates from the sensitive isolates of the bacteria (p &amp;lt; 0.01), and would be used as potential tools in antimicrobial resistance surveillance and clinical diagnosis in veterinary medicine.</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="40">
            <name>Date</name>
            <description>A point or period of time associated with an event in the lifecycle of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10744">
                <text>2020</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="49">
            <name>Subject</name>
            <description>The topic of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10745">
                <text>machine learning, Support vector machine, Set Covering Machine, antimicrobial resistance, Actinobacillus pleuropneumoniae, Genomics</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="43">
            <name>Identifier</name>
            <description>An unambiguous reference to the resource within a given context</description>
            <elementTextContainer>
              <elementText elementTextId="10746">
                <text>DOI: 10.3389/fmicb.2020.00048</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="48">
            <name>Source</name>
            <description>A related resource from which the described resource is derived</description>
            <elementTextContainer>
              <elementText elementTextId="10747">
                <text>Frontiers in Microbiology</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="45">
            <name>Publisher</name>
            <description>An entity responsible for making the resource available</description>
            <elementTextContainer>
              <elementText elementTextId="10748">
                <text>Frontiers Media S.A.</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="38">
            <name>Coverage</name>
            <description>The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant</description>
            <elementTextContainer>
              <elementText elementTextId="10749">
                <text>Microbiology</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="44">
            <name>Language</name>
            <description>A language of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="10750">
                <text>EN</text>
              </elementText>
            </elementTextContainer>
          </element>
        </elementContainer>
      </elementSet>
    </elementSetContainer>
  </item>
</itemContainer>
