404 10 20655 https://www.socictopen.socict.org/files/original/ad367b43d98a8c541688f77a71ae803f.pdf 50331af28098526d5cd2e95b5a4fb0e3 Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Agricultura sostenible Description An account of the resource Dominio científico: Agricultura sostenible Text A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Competitividad y políticas de seguridad alimentaria de las regiones españolas: el caso de la industria cárnica Creator An entity primarily responsible for making the resource José Ruiz Chico, Antonio Rafael Peña Sánchez Description An account of the resource El objetivo fundamental de este trabajo es analizar la competitividad de la industria agroalimentaria y, dentro de ella, el sector cárnico de las regiones españolas a partir de elementos que, sin duda, influyen en esta como: la productividad, los costes salariales y la seguridad alimentaria. Las principales conclusiones obtenidas permiten identificar la enorme potencialidad económica del sector agroalimentario español, y del subsector cárnico en particular. Aspectos como el tipo de carne o el nivel de internacionalización nos ayudan identificar aquellas regiones españolas que requieren un esfuerzo adicional en las políticas alimentarias para evitar que su competitividad sea perjudicada. Date A point or period of time associated with an event in the lifecycle of the resource 2012 Subject The topic of the resource Competitividad|, Productividad aparente del empleo, análisis regional, costes salariales, seguridad alimentaria, trazabilidad Source A related resource from which the described resource is derived Revista Finanzas y Política Económica Publisher An entity responsible for making the resource available Universidad Católica de Colombia Coverage The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant Economics as a science, Finance Relation A related resource <a href="http://editorial.ucatolica.edu.co/ojsucatolica/revistas_ucatolica/index.php/RFYPE/article/view/638" target="_blank" rel="noreferrer noopener">http://editorial.ucatolica.edu.co/ojsucatolica/revistas_ucatolica/index.php/RFYPE/article/view/638</a> https://www.socictopen.socict.org/files/original/69c930f64d6924dd8a5098afd836edc6.pdf f8eaf6ab94521efc76782cec63702ac1 Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Agricultura sostenible Description An account of the resource Dominio científico: Agricultura sostenible Text A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource COMPETITIVIDADE DA AGRICULTURA ORGÂNICA NO ESTADO DO PARANÁ Creator An entity primarily responsible for making the resource Cleiciele Albuquerque Augusto, Maria Iolanda Sachuk Description An account of the resource Nestes primeiros anos do século XXI a degradação ambiental tornou-se assunto prioritário na pauta de discussões dos mais diversos segmentos da sociedade, devido aos alarmantes resultados de pesquisas desenvolvidas sobre o assunto. Assim, faz-se necessário que as mais diversas áreas da ciência façam a sua parte para contribuir com esta empreitada que se apresenta. Para tanto, muitos estudiosos vêm desenvolvendo pesquisas sobre agronegócio, no intuito de mostrar que, em muitos empreendimentos rurais, a agricultura orgânica pode ser competitiva, devido ao valor que agrega ao produto pela chancela do Selo Verde. Deste modo, o objetivo desta pesquisa foi o de verificar quais são os critérios competitivos e as principais características inerentes a este tipo de cultivo no Estado do Paraná. A pesquisa é do tipo descritiva, qualitativa e corte transversal. Os resultados apontaram que a vantagem competitiva deste tipo de cultivo está na diferenciação do produto, em virtude da qualidade auferida pela não utilização de insumos químicos, bem como na preocupação com o meio ambiente. Date A point or period of time associated with an event in the lifecycle of the resource 2008 Identifier An unambiguous reference to the resource within a given context 10.4025/cadadm.v15i2.5131 Source A related resource from which the described resource is derived Caderno de Administração Publisher An entity responsible for making the resource available Universidade Estadual de Maringá Coverage The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant Business, Political institutions and public administration (General) Relation A related resource <a href="http://www.periodicos.uem.br/ojs/index.php/CadAdm/article/view/5131" target="_blank" rel="noreferrer noopener">http://www.periodicos.uem.br/ojs/index.php/CadAdm/article/view/5131</a> https://www.socictopen.socict.org/files/original/ce1ec052e4f2b862494e09db93d2be06.pdf 6ba0cba27f7ee6fd42cd521e33b7078e Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Agricultura sostenible Description An account of the resource Dominio científico: Agricultura sostenible Text A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Competitividade das Agroindustrias do Oeste Catarinense no Ambito do Mercosul: Considerações Preliminares Creator An entity primarily responsible for making the resource Carlos José Espindola Description An account of the resource As duas últimas décadas marcam uma profunda e indiscutível virada na vida econômica, com mudanças significativas nas estruturas de desenvolvimento regional/nacional/mundial. De um lado, presencia-se o aumento dos fluxos financeiros e restruturações do processo produtivo decorrente do novo paradigma tecnológico e, de outro lado, a constituição de agrupamentos politico-econômicos em escala regional. Date A point or period of time associated with an event in the lifecycle of the resource 1999 Subject The topic of the resource Competitividade das Agroindustrias, Oeste Catarinense Competitividade Source A related resource from which the described resource is derived Geosul Publisher An entity responsible for making the resource available Universidade Federal de Santa Catarina Coverage The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant Geography (General), Human ecology. Anthropogeography, Physical geography Relation A related resource <a href="https://periodicos.ufsc.br/index.php/geosul/article/view/15025" target="_blank" rel="noreferrer noopener">https://periodicos.ufsc.br/index.php/geosul/article/view/15025</a> https://www.socictopen.socict.org/files/original/251f6e4f15a8ba54aaf70dff3c47cda7.pdf 1189e04e0da510cb94dad21915752117 Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Agricultura sostenible Description An account of the resource Dominio científico: Agricultura sostenible Text A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Complejidad e interdisciplina en las nuevas perspectivas socio-ecológicas: el caso de la ecología política urbana anclada en nociones metabólicas Creator An entity primarily responsible for making the resource Gian Carlo Delgado Ramos Description An account of the resource El trabajo abre con la discusión sobre el carácter complejo de los problemas ambientales derivados de la interacción y transformación de la naturaleza por parte del ser humano o lo que se ha denominado también como metabolismo social, para posteriormente argumentar que su análisis demanda de una aproximación propia de los sistemas complejos y la interdisciplina. Se continua con una discusión sobre las nuevas perspectivas ecológicas híbridas que se vienen construyendo ante la agudización de la crisis socioecológica y su complejidad. Al abogar por la necesidad de apostar por una co-producción de conocimiento de caracter reflexiva y participativa, propia de la ciencia posnormal y la interdisciplina, se presentan las principales características deseables y las patologías imperantes en la actual forma de intercambiar conocimientos y, en sí, de producción de conocimiento para el caso de la cuestión socioambiental. La discusión se ejemplifica al dar cuenta del caso de la ecología política del metabolismo urbano, un campo híbrido en construcción de frontera. Se concluye abogando por la pertinencia de la convergencia de enfoques interdisciplinarios como característica fundamental de la coproducción de conocimiento hibridado, útil para la toma de decisiones socialmente concensuada y soportada en conocimiento robusto derivado de procesos de coproducción participativos. Date A point or period of time associated with an event in the lifecycle of the resource 2015 Subject The topic of the resource Complejidad, Interdisciplinar, campos híbridos, crisis socioeconómica, ecología política urbana, metabolismo urbano Identifier An unambiguous reference to the resource within a given context 10.17141/letrasverdes.17.2015.1442 Source A related resource from which the described resource is derived Letras Verdes: Revista Latinoamericana de Estudios Socioambientales Publisher An entity responsible for making the resource available Facultad Latinoamericana de Ciencias Sociales, Sede Ecuador Coverage The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant Environmental sciences, Human ecology. Anthropogeography Relation A related resource <a href="http://revistas.flacsoandes.edu.ec/letrasverdes/article/view/1442" target="_blank" rel="noreferrer noopener">http://revistas.flacsoandes.edu.ec/letrasverdes/article/view/1442</a> https://www.socictopen.socict.org/files/original/13c93533b5ab9c4356f31088290d640e.pdf 885c088f2e998217a28a058269673963 Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Coronavirus Description An account of the resource Dominio científico: Coronavirus Text A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Complement Activation Contributes to Severe Acute Respiratory Syndrome Coronavirus Pathogenesis Creator An entity primarily responsible for making the resource Lisa E Gralinski, Timothy P. Sheahan, Thomas E. Morrison, Vineet D. Menachery, Kara Jensen, Sarah R. Leist, Alan Whitmore, Mark T. Heise, Ralph S. Baric Description An account of the resource The complement system is a critical part of host defense to many bacterial, viral, and fungal infections. It works alongside pattern recognition receptors to stimulate host defense systems in advance of activation of the adaptive immune response. In this study, we directly test the role of complement in SARS-CoV pathogenesis using a mouse model and show that respiratory disease is significantly reduced in the absence of complement even though viral load is unchanged. Complement-deficient mice have reduced neutrophilia in their lungs and reduced systemic inflammation, consistent with the observation that SARS-CoV pathogenesis is an immune-driven disease. These data suggest that inhibition of complement signaling might be an effective treatment option following coronavirus infection.Acute respiratory distress syndrome (ARDS) is immune-driven pathologies that are observed in severe cases of severe acute respiratory syndrome coronavirus (SARS-CoV) infection. SARS-CoV emerged in 2002 to 2003 and led to a global outbreak of SARS. As with the outcome of human infection, intranasal infection of C57BL/6J mice with mouse-adapted SARS-CoV results in high-titer virus replication within the lung, induction of inflammatory cytokines and chemokines, and immune cell infiltration within the lung. Using this model, we investigated the role of the complement system during SARS-CoV infection. We observed activation of the complement cascade in the lung as early as day 1 following SARS-CoV infection. To test whether this activation contributed to protective or pathologic outcomes, we utilized mice deficient in C3 (C3–/–), the central component of the complement system. Relative to C57BL/6J control mice, SARS-CoV-infected C3–/– mice exhibited significantly less weight loss and less respiratory dysfunction despite equivalent viral loads in the lung. Significantly fewer neutrophils and inflammatory monocytes were present in the lungs of C3–/– mice than in C56BL/6J controls, and subsequent studies revealed reduced lung pathology and lower cytokine and chemokine levels in both the lungs and the sera of C3–/– mice than in controls. These studies identify the complement system as an important host mediator of SARS-CoV-induced disease and suggest that complement activation regulates a systemic proinflammatory response to SARS-CoV infection. Furthermore, these data suggest that SARS-CoV-mediated disease is largely immune driven and that inhibiting complement signaling after SARS-CoV infection might function as an effective immune therapeutic. Date A point or period of time associated with an event in the lifecycle of the resource 2018 Subject The topic of the resource SARS-CoV, animal models, complement, coronavirus, Respiratory viruses Identifier An unambiguous reference to the resource within a given context DOI: 10.1128/mBio.01753-18 Source A related resource from which the described resource is derived mBio Publisher An entity responsible for making the resource available American Society for Microbiology Coverage The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant Microbiology Language A language of the resource EN https://www.socictopen.socict.org/files/original/91713171aabf4768f067a0b700d81d43.pdf 04e22f4e30541f303b98974b95656052 Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Coronavirus Description An account of the resource Dominio científico: Coronavirus Text A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Complement C5 inhibition in patients with COVID-19 - a promising target? Creator An entity primarily responsible for making the resource Regis Peffault de Latour, Anne Bergeron, Etienne Lengline, Thibault Dupont, Armance Marchal, Lionel Galicier, Nathalie de Castro, Louise Bondeelle, Michael Darmon, Clairelyne Dupin, Guillaume Dumas, Pierre Leguen, Isabelle Madelaine, Sylvie Chevret, Jean-Michel Molina, Elie Azoulay, Veronique Fremeaux-Bacchi, Core Group Date A point or period of time associated with an event in the lifecycle of the resource 2020 Identifier An unambiguous reference to the resource within a given context 10.3324/haematol.2020.260117 Source A related resource from which the described resource is derived Haematologica https://www.socictopen.socict.org/files/original/fd3978a1ec2c92dc153b965cc1a41891.pdf 0fdc76e6572e67c226d462c8a354fe96 Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Coronavirus Description An account of the resource Dominio científico: Coronavirus Text A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Complement Receptor C5aR1 Inhibition Reduces Pyroptosis in hDPP4-Transgenic Mice Infected with MERS-CoV Creator An entity primarily responsible for making the resource Yuting Jiang, Junfeng Li, Yue Teng, Hong Sun, Guang TIAN, Lei He, Pei Li, Yuehong Chen, Yan Guo, Jiangfan Li, Guangyu Zhao, Yusen Zhou, Shihui Sun Description An account of the resource Middle East respiratory syndrome coronavirus (MERS-CoV) is a highly pathogenic virus with a crude mortality rate of ~35%. Previously, we established a human DPP4 transgenic (hDPP4-Tg) mouse model in which we studied complement overactivation-induced immunopathogenesis. Here, to better understand the pathogenesis of MERS-CoV, we studied the role of pyroptosis in THP-1 cells and hDPP4 Tg mice with MERS-CoV infection. We found that MERS-CoV infection induced pyroptosis and over-activation of complement in human macrophages. The hDPP4-Tg mice infected with MERS-CoV overexpressed caspase-1 in the spleen and showed high IL-1&beta; levels in serum, suggesting that pyroptosis occurred after infection. However, when the C5a-C5aR1 axis was blocked by an anti-C5aR1 antibody (Ab), expression of caspase-1 and IL-1&beta; fell. These data indicate that MERS-CoV infection induces overactivation of complement, which may contribute to pyroptosis and inflammation. Pyroptosis and inflammation were suppressed by inhibiting C5aR1. These results will further our understanding of the pathogenesis of MERS-CoV infection. Date A point or period of time associated with an event in the lifecycle of the resource 2019 Subject The topic of the resource MERS-CoV, inflammation, pyroptosis, complement Identifier An unambiguous reference to the resource within a given context DOI: 10.3390/v11010039 Source A related resource from which the described resource is derived Viruses Publisher An entity responsible for making the resource available MDPI AG Coverage The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant Microbiology Language A language of the resource EN https://www.socictopen.socict.org/files/original/f89107ceae7644bb8b207289261c3f2a.pdf d79cdafeed83c75165e77a02bafb5c95 Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Agricultura sostenible Description An account of the resource Dominio científico: Agricultura sostenible Text A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Complementarity of energy resources for the electrical generation: a review Creator An entity primarily responsible for making the resource Angélica Vanessa Aldana Urrea, Diego Julián Rodríguez Patarroyo Description An account of the resource Ante las necesidades de aumentar los índices de cobertura eléctrica, generar medidas para la adaptación al cambio climático y diversificar la matriz energética de los países, se han desarrollado diversos estudios para establecer la complementariedad entre recursos energéticos. En este sentido, este documento presenta una revisión bibliográfica de algunas regiones a nivel mundial, para evidenciar las iniciativas investigativas alrededor del estudio de la complementariedad energética. Esta revisión incluye estudios que, además de establecer la complementariedad entre recursos solares, eólicos e hídricos, incluyen demanda, precios de electricidad, etcétera. De los resultados obtenidos se destaca que, si bien diversos estudios realizados en todo el mundo han demostrado que la mayor parte de la producción de sistemas de energía renovable presenta una naturaleza variable y, en parte, impredecible, hacer uso de más de un tipo de energía renovable mejora el rendimiento de estos sistemas, disminuye las fluctuaciones en la generación y aumenta la confiabilidad del sistema. Asimismo, se encuentra que el método más utilizado para la evaluación de complementariedad energética es el factor de correlación. Otros métodos incluyen simulaciones, aplicación de modelos y algoritmos de optimización. La información insumo para la realización de estos estudios proviene de los registros de los sistemas eléctricos de potencia de los países, de la aplicación de modelos de predicción meteorológica, de datos climatológicos históricos procedentes de satélites o de mediciones de estaciones meteorológicas, entre otros. Para Colombia se observan oportunidades de generar conocimiento alrededor de la complementariedad de los recursos energéticos. Date A point or period of time associated with an event in the lifecycle of the resource 2019 Subject The topic of the resource Energía Solar, complementariedad energética, energia eólica, energía hidráulica, energía renovable, seguridad energética Identifier An unambiguous reference to the resource within a given context 10.18359/rcin.3625 Source A related resource from which the described resource is derived Ciencia e Ingeniería Neogranadina Publisher An entity responsible for making the resource available Universidad Militar Nueva Granada Coverage The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant Engineering (General). Civil engineering (General), Science Relation A related resource <a href="http://www.redalyc.org/articulo.oa?id=91163366002" target="_blank" rel="noreferrer noopener">http://www.redalyc.org/articulo.oa?id=91163366002</a> https://www.socictopen.socict.org/files/original/3d4bfe033ba91dc7d10e76caef99e674.pdf d980bc9f26fb7e0dbb46eb56831877a5 Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Coronavirus Description An account of the resource Dominio científico: Coronavirus Text A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus Creator An entity primarily responsible for making the resource Chang Liu, Ze Chen, Yue Hu, Haishuo Ji, Deshui Yu, Wenyuan Shen, Si-Yu Li, Jishou Ruan, Wenjun Bu, Shan Gao Description An account of the resource In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes. Date A point or period of time associated with an event in the lifecycle of the resource 2018 Subject The topic of the resource palindromic small RNA, complemented palindromic small RNA, small RNA, DNA complemented palindrome, severe acute respiratory syndrome coronavirus Identifier An unambiguous reference to the resource within a given context DOI: 10.3390/genes9090442 Source A related resource from which the described resource is derived Genes Publisher An entity responsible for making the resource available MDPI AG Coverage The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant Genetics Language A language of the resource EN https://www.socictopen.socict.org/files/original/dc76bbc4ce83a5496a28e595a05446ee.pdf 848b4100d560a27f7bcf6e0ba05d98e7 Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Coronavirus Description An account of the resource Dominio científico: Coronavirus Text A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Complete genomic sequence analysis of infectious bronchitis virus Ark DPI strain and its evolution by recombination Creator An entity primarily responsible for making the resource Gelb Jack, Upadhyay Chitra, Ammayappan Arun, Vakharia Vikram N Description An account of the resource Abstract An infectious bronchitis virus Arkansas DPI (Ark DPI) virulent strain was sequenced, analyzed and compared with many different IBV strains and coronaviruses. The genome of Ark DPI consists of 27,620 nucleotides, excluding poly (A) tail, and comprises ten open reading frames. Comparative sequence analysis of Ark DPI with other IBV strains shows striking similarity to the Conn, Gray, JMK, and Ark 99, which were circulating during that time period. Furthermore, comparison of the Ark genome with other coronaviruses demonstrates a close relationship to turkey coronavirus. Among non-structural genes, the 5'untranslated region (UTR), 3C-like proteinase (3CLpro) and the polymerase (RdRp) sequences are 100% identical to the Gray strain. Among structural genes, S1 has 97% identity with Ark 99; S2 has 100% identity with JMK and 96% to Conn; 3b 99%, and 3C to N is 100% identical to Conn strain. Possible recombination sites were found at the intergenic region of spike gene, 3'end of S1 and 3a gene. Independent recombination events may have occurred in the entire genome of Ark DPI, involving four different IBV strains, suggesting that genomic RNA recombination may occur in any part of the genome at number of sites. Hence, we speculate that the Ark DPI strain originated from the Conn strain, but diverged and evolved independently by point mutations and recombination between field strains. Date A point or period of time associated with an event in the lifecycle of the resource 2008 Identifier An unambiguous reference to the resource within a given context DOI: 10.1186/1743-422X-5-157 Source A related resource from which the described resource is derived Virology Journal Publisher An entity responsible for making the resource available BMC Coverage The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant Infectious and parasitic diseases Language A language of the resource EN